Class TestCasesStructuralInv
- java.lang.Object
-
- org.snpeff.snpEffect.testCases.unity.TestCasesBase
-
- org.snpeff.snpEffect.testCases.unity.TestCasesStructuralInv
-
public class TestCasesStructuralInv extends TestCasesBase
Test cases for structural variants: Inversions Gene models used in these test cases: Gene: Gene_1:953-1216 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG? 1 0 1 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567 gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac V A * I L Y S L A I V V L L T R H G 01201201201201201201201201201201 2012012012012 0120120120 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>> | | | | | | | | | | | ^1157 | | | | ^1148 | | | ^1057 | | ^1045 | ^988 ^957 Gene: Gene_1:2057-2157 1:2066-2141, strand: +, id:transcript_1, Protein Exons: 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg CDS : acttcccttttacgcccacgtccgccgctg Protein : TSLLRPRPPL 1 7 8 9 0 1 2 3 4 6789012345678901234567890123456789012345678901234567890123456789012345678901 actt..............cccttt..........................tacgcccacgt......ccgccgctg T S L L R P R P P L 0120 120120 12012012012 012012012 >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>> | | | | | | | | | | | | | | | ^2141 | | | | | | ^2133 | | | | | ^2126 | | | | ^2116 | | | ^2089 | | ^2084 | ^2069 ^2066
-
-
Field Summary
-
Fields inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
addUtrs, chromoBases, chromoSequence, chromosome, codonTable, config, debug, gene, genome, genomeName, maxExons, maxGeneLen, maxTranscripts, minExons, numGenes, onlyMinusStrand, onlyPlusStrand, rand, randSeed, shiftHgvs, snpEffectPredictor, spliceRegionExonSize, spliceRegionIntronMax, spliceRegionIntronMin, transcript, verbose
-
-
Constructor Summary
Constructors Constructor Description TestCasesStructuralInv()
-
Method Summary
All Methods Instance Methods Concrete Methods Modifier and Type Method Description protected voidcheckEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)protected voidcheckEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns, Gene[] genesToAdd)protected voidinit()voidtest01_invGene()Inversion: Whole genevoidtest01_invTr()Inversion: whole transcriptvoidtest02()Inversion: One coding exonvoidtest03()Inversion: Two coding exonsvoidtest04()Inversion: Part of one coding exonvoidtest05()Inversion: Part of two coding exonvoidtest06()Inversion: Two genesvoidtest07()Inversion: Part of two genes (fusions) cutting on intronsvoidtest08()Inversion: Part of two genes (fusions) cutting exonsvoidtest09()Inversion: Intronvoidtest10()Inversion creating a fusion between two pairs (i.e.-
Methods inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
after, before, checkApply, checkApplyDel, checkApplyIns, checkApplyMixed, checkApplyMnp, checkApplySnp, checkEffect, checkEffect, formatVersion, hasEffect, initRand, initSnpEffPredictor, initSnpEffPredictor, prependSequenceToFirstExon, showTranscripts
-
-
-
-
Method Detail
-
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)
-
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns, Gene[] genesToAdd)
-
init
protected void init()
- Overrides:
initin classTestCasesBase
-
test01_invGene
public void test01_invGene()
Inversion: Whole gene
-
test01_invTr
public void test01_invTr()
Inversion: whole transcript
-
test02
public void test02()
Inversion: One coding exon
-
test03
public void test03()
Inversion: Two coding exons
-
test04
public void test04()
Inversion: Part of one coding exon
-
test05
public void test05()
Inversion: Part of two coding exon
-
test06
public void test06()
Inversion: Two genes
-
test07
public void test07()
Inversion: Part of two genes (fusions) cutting on introns
-
test08
public void test08()
Inversion: Part of two genes (fusions) cutting exons
-
test09
public void test09()
Inversion: Intron
-
test10
public void test10()
Inversion creating a fusion between two pairs (i.e. four genes)
-
-