Class TestCasesStructuralTranslocations
- java.lang.Object
-
- org.snpeff.snpEffect.testCases.unity.TestCasesStructuralTranslocations
-
public class TestCasesStructuralTranslocations extends java.lang.ObjectTest case for structural variants: Translocation (fusions) We create two genes (one transcript each). Each gene is in one different chromosome Transcripts: 1:10-90, strand: +, id:tr1, Protein Exons: 1:10-30 'exon1', rank: 1, frame: ., sequence: tatttgtatgaggatttgagt 1:40-90 'exon2', rank: 2, frame: ., sequence: tactcagtgctgggcaatcccttagctgtcgcgccgcttaccctactattc CDS : tatttgtatgaggatttgagttactcagtgctgggcaatcccttagctgtcgcgccgcttaccctactattc Protein : YLYEDLSYSVLGNPLAVAPLTLLF 2:110-190, strand: +, id:tr2, Protein Exons: 2:110-125 'exon3', rank: 1, frame: ., sequence: gttaatgggatttcac 2:150-190 'exon4', rank: 2, frame: ., sequence: atgggaacggagtgtcgacagcaccttatggggagctatat CDS : gttaatgggatttcacatgggaacggagtgtcgacagcaccttatggggagctatat Protein : VNGISHGNGVSTAPYGELY Genes diagram: [ Chr1: Gene1 ] >>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | | | | ^10 ^30 ^40 ^90 [ Chr2: Gene2 ] >>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | | | | ^110 ^125 ^150 ^190
-
-
Constructor Summary
Constructors Constructor Description TestCasesStructuralTranslocations()
-
Method Summary
All Methods Instance Methods Concrete Methods Modifier and Type Method Description protected voidcheckEffects(Variant variant, EffectType[] expEffs, EffectType[] notExpEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)voidinit(boolean gene1NegativeStrand, boolean gene2NegativeStrand)voidtest01_0()Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 .voidtest01_0_nonFs()Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 .voidtest01_1()Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest01_2()Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest01_3()Translocation in the same direction (both genes in negative strand) #CHROM POS ID REF ALT chr1 35 .voidtest01_3_noFs()Translocation in the same direction (both genes in negative strand) #CHROM POS ID REF ALT chr1 35 .voidtest02_0()Translocation in opposite directions (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 .voidtest02_1()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest02_1_nonFs()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest02_2()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest02_2_nonFs()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest02_3()Translocation in the opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest03_0()Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest03_1()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest03_1_nonFs()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest03_2()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest03_2_nonFs()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest03_3()Translocation in the opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest04_0()Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 .voidtest04_0_nonFs()Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 .voidtest04_1()Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest04_2()Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 .voidtest04_3()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest04_3_nonFs()Translocation in the same direction #CHROM POS ID REF ALT chr1 35 .voidtest05_1_one_gene()Translocation affecting a gene and an intergenic region [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>..............................................................................................................voidtest05_2_one_gene()Translocation affecting a gene and an intergenic region [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>..............................................................................................................voidtest06_no_gene()Translocation not affecting any gene (intergenic regions) [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>..............................................................................................................
-
-
-
Method Detail
-
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, EffectType[] notExpEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)
-
init
public void init(boolean gene1NegativeStrand, boolean gene2NegativeStrand)
-
test01_0
public void test01_0()
Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: >>>>>>>>>>>---- | gene2 ---->>>>>>>>>
-
test01_0_nonFs
public void test01_0_nonFs()
Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: >>>>>>>>>>>---- | gene2 ---->>>>>>>>>>>>---
-
test01_1
public void test01_1()
Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: >>>>>>>>>>>---- | gene2 ----<<<<<<<<<<<<---
-
test01_2
public void test01_2()
Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: <<<<<<<<<<<<---- | gene2 ---->>>>>>>>>----
-
test01_3
public void test01_3()
Translocation in the same direction (both genes in negative strand) #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: <<<<<<<<<<<<---- | gene2 ----<<<<<<<<<<<<---
-
test01_3_noFs
public void test01_3_noFs()
Translocation in the same direction (both genes in negative strand) #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[ gene1: <<<<<<<<<<<<---- | gene2 --<<<<<<<<<<<<---
-
test02_0
public void test02_0()
Translocation in opposite directions (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: >>>>>>>>>>>---- | gene2 >>>>>>>>>>>----
-
test02_1
public void test02_1()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: >>>>>>>>>>>---- | gene2 <<<<<<<<<<<----
-
test02_1_nonFs
public void test02_1_nonFs()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: >>>>>>>>>>>---- | gene2 -----<<<<<<<<<<<----
-
test02_2
public void test02_2()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: <<<<<<<<<<<---- | gene2 >>>>>>>>>>>----
-
test02_2_nonFs
public void test02_2_nonFs()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: <<<<<<<<<<<---- | gene2 ----->>>>>>>>>>>----
-
test02_3
public void test02_3()
Translocation in the opposite directions #CHROM POS ID REF ALT chr1 35 . N N]chr2:140] gene1: <<<<<<<<<<<---- | gene2 <<<<<<<<<<<----
-
test03_0
public void test03_0()
Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>----
-
test03_1
public void test03_1()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<----
-
test03_1_nonFs
public void test03_1_nonFs()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<----
-
test03_2
public void test03_2()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: ---<<<<<<<<<<<---- | gene2 --->>>>>>>>>>>----
-
test03_2_nonFs
public void test03_2_nonFs()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: ---<<<<<<<<<<<---- | gene2 >>>>>>>>>>>----
-
test03_3
public void test03_3()
Translocation in the opposite directions #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N gene1: ---<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----
-
test04_0
public void test04_0()
Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>----
-
test04_0_nonFs
public void test04_0_nonFs()
Translocation in the same direction (both genes in positive strand) #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>
-
test04_1
public void test04_1()
Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<<----
-
test04_2
public void test04_2()
Translocation in opposite directions #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: ---<<<<<<<<<<<<<<---- | gene2 --->>>>>>>>>>>----
-
test04_3
public void test04_3()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: ---<<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----
-
test04_3_nonFs
public void test04_3_nonFs()
Translocation in the same direction #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N gene1: ---<<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----
-
test05_1_one_gene
public void test05_1_one_gene()
Translocation affecting a gene and an intergenic region [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 | ^40 ^90 | |> ------------------ <| | | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]
-
test05_2_one_gene
public void test05_2_one_gene()
Translocation affecting a gene and an intergenic region [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 ^40 ^90 | |> ------------ <| | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]
-
test06_no_gene
public void test06_no_gene()
Translocation not affecting any gene (intergenic regions) [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 ^40 ^90 | <|------------------------------------------------------------------------------------|> | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]
-
-